Confirmation of cross-pollination of Ardisia crenata by sequence-characterized amplified region (SCAR) markers

To investigate the origin of seven Ardisia crenata Sims seedlings with non-variegated foliages (VSm) from a progeny of a mother plant with variegated foliage and red berries (VM), morphological and genetic characteristics of these seedlings were compared with mother plants of A. crenata with VM, plants with non-variegated leaves and white berries (WM), and plants with non-variegated leaves and red berries (RM). Genetic data include randomly amplified polymorphic DNA (RAPD) markers and sequence analysis of an unidentified locus that was obtained from seven VSm seedlings out of 261seedlings of VM with variegated foliage (VS) seedlings, WM, and seedlings from WM (WS). RAPD analysis indicates that VM, WM, and progeny populations VSm and WS are more closely related to each other than to RM and RM progeny (RS). Substitution in a 374-base long nucleotide sequence revealed that WM and most of WS and VSm produced similar sequence data with some exceptions, such as seedling VSm 2 and 5 showing polymorphisms at positions 7 (C replacing T) and 243 (A replacing T). Based on the RAPD and the sequence analysis for the VSm and WM specific band, it is concluded that these seven VSm seedlings were resulted from cross-pollination between VM and WM. Hybrid origin of VSm seedlings between VM as a maternal source and WM as a paternal source is verified by polymerase chain reaction (PCR) utilizing sequence-characterized amplified region (SCAR) markers (forward primer, ARD-1-F; GGACTGGAGTAGAGGATAGAGTTTTG and two reverse primers, ARD-2-R; GGACTGGAGTGCTCTATGAATTG and ARD-3-R; TGTCAGCAGCCTACCACTAGC). These SCAR markers were successful to identify VM progenies with non-variegated leaves involving WM as a paternal source. Published by Elsevier B.V.